View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_228 (Length: 255)
Name: NF0928_low_228
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_228 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 19755950 - 19755725
Alignment:
| Q |
1 |
cttctgagtcttcttcgaaaaagacgaaacagagtggagaagaagtaaattctttacacctttgtgtgcattggtattttcttttcaaaatttactaaca |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19755950 |
cttctgagccttcttcgaaaaagacgaaacagagtggagaagaagtaagttctttacacatttgtgtgcattggtattttctttccaaaatttactaaca |
19755851 |
T |
|
| Q |
101 |
ccaaatttttcttctagtccgatgtttcacttaaatccatcaaagttgctgaaaaagcaactgtttatgagattcgaattgagaaggagaagaaaagaaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19755850 |
ccaattttttcttctagtccgatgtttcacttaaatccatcaaagttgctgaaaaagcaattgtttctgagattcgaattgagaaggagaagaaaagaaa |
19755751 |
T |
|
| Q |
201 |
acatgctcaagaaaaacccaaagatt |
226 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
19755750 |
acatgctcaaaaaaaacccaaagatt |
19755725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 538 times since January 2019
Visitors: 6717