View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_232 (Length: 254)
Name: NF0928_low_232
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_232 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 31078038 - 31078263
Alignment:
| Q |
1 |
aaagtcattatatagtttcttgctatttttatttaaaagtcatgtcaccaaatgtatcttaagccgtcttactcatgataggaataagagtc-attttaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31078038 |
aaagtcattatatagtttcttgctatttttatttaaaagtcatgtcaccagatgtatcttaagccgtcttactcatgataggaataagagtcttttttaa |
31078137 |
T |
|
| Q |
100 |
taagtatcttaaagacattgtttaaggaacccatnnnnnnnnnttatgaaaaatatatgaattatgaaatgaatcaattacacagtacaccagcattgta |
199 |
Q |
| |
|
||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31078138 |
taagtgccttaaagacattgtttaaggaatccataaaaaaaaattatgaaaaatatatgaattatgaaatgaatcaattacacagtacaccagcattgta |
31078237 |
T |
|
| Q |
200 |
cgtatagctattttctacatgtataa |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31078238 |
cgtatagctattttctacatgtataa |
31078263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 473 times since January 2019
Visitors: 6704