View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_241 (Length: 252)
Name: NF0928_low_241
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_241 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 252
Target Start/End: Original strand, 5124609 - 5124830
Alignment:
| Q |
29 |
acatacttcaatgaaatccttgcattttttaactaaaaatctgagatgaaaatgcttatgaacaactagttaaagaaaattgttactgcatatttggacc |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5124609 |
acatacttcaatgaaatccttgcattttttaactaaaaatctgagatgaaaatgcttatgaacaa--agttaaagaaaattgttactgcatatttggact |
5124706 |
T |
 |
| Q |
129 |
gacggcaattttcattgtgtgctatcatagtttttatataagctacgctttgtagcttcaacaaaattacagtgttattgtcatttcgctaaactcgcag |
228 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5124707 |
gacggcgattttcattgtgtgctaccatagtttttatataagctacgctttgtagcttcaacaaaattacagtgttattgtcatttcgctaaactcgcag |
5124806 |
T |
 |
| Q |
229 |
tcaattgaaacatgtactaaaatt |
252 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5124807 |
tcaattgaaacatgtactaaaatt |
5124830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University