View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_247 (Length: 251)
Name: NF0928_low_247
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_247 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 85 - 219
Target Start/End: Original strand, 35166205 - 35166339
Alignment:
Q |
85 |
caggctttatggacgaagacaatcagagaagttgttggttagtacatcagtggctgaatcttgactgtgtgatttaaaattaattttaaaattaattcat |
184 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
T |
35166205 |
caggctttatggatgaagacaatcagagaagttgttggttagtacatcagtggctgaatcttgactatgtgatttaaaatgaattttaaaattaattcat |
35166304 |
T |
 |
Q |
185 |
acatcaaaatttatgggtttggggcttatttagta |
219 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
35166305 |
acatcaaaatttatgggtttggggcttatttagta |
35166339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 28 - 66
Target Start/End: Original strand, 35166144 - 35166182
Alignment:
Q |
28 |
caacattggtttatctttattaatcgaacgtgcttcatg |
66 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35166144 |
caacattggtttatctttattaatcgaacgtgcttcatg |
35166182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University