View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_250 (Length: 251)
Name: NF0928_low_250
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_250 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 9641673 - 9641914
Alignment:
Q |
10 |
aataatatgaggcaatcaaatatttcaaaggtgaactatgattaaactattttcatataagttatagttcataaaaaatcttaa-gagaatttattgaaa |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
9641673 |
aataatatgaggcaatcaaatatttcaaaggtgaactatgattaaactattttcatataagttatagttcataaaaaatcttaaagagaatttattgaaa |
9641772 |
T |
 |
Q |
109 |
gaaactgaatatttaacttatgataataaatcataagctatatttatagttcatccaaatattcaggcaactgtttatgatagaatctagtagacttaat |
208 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9641773 |
gaaactgaatatt-aacttatgataataaatcataagctatatttatagttcatccaaatattcaggcaactgtttatgatagaatctagtagacttaat |
9641871 |
T |
 |
Q |
209 |
gattttgatattatggtgatataaatgataaacttaccacata |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9641872 |
gattttgatattatggtgatataaatgataaacttaccacata |
9641914 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University