View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_251 (Length: 251)
Name: NF0928_low_251
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_251 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 33716746 - 33716524
Alignment:
Q |
16 |
atgattcatcgtgatgatcccgtgaaagcttttctacattaggcnnnnnnncctttggtgtggtagctatgagtttgaaaaaatgttgcaaaacaaaact |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33716746 |
atgattcatcgtgatgatcccgtgaaagcttttctacattaggcttcttttcccttggtgtggtagctatgagtttgaaaaaatgttgcaaaacaaaact |
33716647 |
T |
 |
Q |
116 |
actgatcacagttcttggttatttgtttagctcttgaactggttggtgtttcctattgtgtaaatgcatgtattggtttgcaatgacttcttttgtatta |
215 |
Q |
|
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
33716646 |
gctgatgacagttcttggt-------------cttgaactggttggtgtttcctattgtgtaaatgtatgtattggtttgcaatgacttcttttgtatta |
33716560 |
T |
 |
Q |
216 |
tgggtcactcaacctcatcaagagtgtgtttgatac |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
33716559 |
tgggtcactcaacctcatcaagagtgtgtttgatac |
33716524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 460 times since January 2019
Visitors: 6704