View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_255 (Length: 251)

Name: NF0928_low_255
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_255
NF0928_low_255
[»] chr1 (1 HSPs)
chr1 (15-237)||(47126343-47126565)


Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 47126565 - 47126343
Alignment:
15 gacccaagtttgaagaacagaaatgggccagtgaaattgccatatacccttctgtttcccaatacctctgattattctagggagggtggactcactggta 114  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47126565 gacccaagtttgaagaacagaaatgggccagtgaaattgccttatacccttctgtttcccaatacctctgattattctagggagggtggactcactggta 47126466  T
115 agggaattcccaacagcatatccatctgaaaccattctctttgaattcttgctatttatctaaccaaagacttagctttggtatcgaataaactatgtat 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||    
47126465 agggaattcccaacagcatatccatctgaaaccattctctttgaatttttgctatttatctaaccaaagacttagctttggtgtcgaataaactatgtat 47126366  T
215 caccgacactttagattgaaggt 237  Q
    |||||||||||||||||||||||    
47126365 caccgacactttagattgaaggt 47126343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 946 times since January 2019
Visitors: 6707