View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_257 (Length: 251)
Name: NF0928_low_257
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_257 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 32261164 - 32261399
Alignment:
Q |
16 |
atcaggcaaaggttgtttttagcaaaacatggattggacatatattctatttacttgggacaaatttacagtgagaatcaaatcaaaattacaaatttga |
115 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
32261164 |
atcaagcaaaggttgtttttagcaaaacatggattggacatatattctatttacttggtacaaatttacagtgagaatcaaatcaaaattgcaaatttga |
32261263 |
T |
 |
Q |
116 |
aagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataatctatagacaatcaatgt |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32261264 |
aagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataatctatagacaatcaatgt |
32261363 |
T |
 |
Q |
216 |
tcaaaatgttaacaatgatcaaagttgctcccatta |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
32261364 |
tcaaaatgttaacaatgatcaaagttgctcccatta |
32261399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1349 times since January 2019
Visitors: 6712