View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_257 (Length: 251)
Name: NF0928_low_257
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_257 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 32261164 - 32261399
Alignment:
| Q |
16 |
atcaggcaaaggttgtttttagcaaaacatggattggacatatattctatttacttgggacaaatttacagtgagaatcaaatcaaaattacaaatttga |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32261164 |
atcaagcaaaggttgtttttagcaaaacatggattggacatatattctatttacttggtacaaatttacagtgagaatcaaatcaaaattgcaaatttga |
32261263 |
T |
|
| Q |
116 |
aagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataatctatagacaatcaatgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261264 |
aagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataatctatagacaatcaatgt |
32261363 |
T |
|
| Q |
216 |
tcaaaatgttaacaatgatcaaagttgctcccatta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261364 |
tcaaaatgttaacaatgatcaaagttgctcccatta |
32261399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1349 times since January 2019
Visitors: 6712