View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_258 (Length: 251)
Name: NF0928_low_258
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_258 |
 |  |
|
| [»] scaffold0386 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 6068179 - 6068416
Alignment:
| Q |
1 |
aaagacccgcggcaaatacatataattgagtcccttaagcatggaaaatttcttgctggaaaaggaaaattccatgttagtgatctctacgcctcgaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6068179 |
aaagacccgcggcaaatacatataattgagtcccttaagcatggaaaatttcttgttggaataggaaaattccatgttagtgttctctacgcctcgaaga |
6068278 |
T |
 |
| Q |
101 |
ggattttgtctctcgctcgctaccactgtcttagaagttcttttccagtgattcatggttcccctagaagtgatataatcataagaatgtgcaaatagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6068279 |
ggattttgtctctcgctcgctaccactgtcttagaagttcttttccagtgattcatggttcccctagaagtgatataatcataagaatgtgcaaatagtt |
6068378 |
T |
 |
| Q |
201 |
accggtcggcaatatatagaacacatattttctttaat |
238 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068379 |
actggtcggcaatatatagaacacatattttctttaat |
6068416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 109
Target Start/End: Original strand, 15641 - 15693
Alignment:
| Q |
57 |
tggaaaaggaaaattccatgttagtgatctctacgcctcgaagaggattttgt |
109 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||| || ||||||||||| |
|
|
| T |
15641 |
tggaataggcaaattccatgttagtgatctctaagcctagaggaggattttgt |
15693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University