View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_275 (Length: 238)
Name: NF0928_low_275
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_275 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 25 - 132
Target Start/End: Original strand, 36753717 - 36753824
Alignment:
| Q |
25 |
taaagcatagctacgtgaaaatgagggaattatttactaataccactaccagtgccaacaagaagaaaagtgacacatccctgactttcacgaaagacta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36753717 |
taaagcatagctacgtgaaaatgagggaattatttactactactactaccagtgccaacaagaagaaaagtgacacatccctgactttcacgaaagactg |
36753816 |
T |
 |
| Q |
125 |
ccattcat |
132 |
Q |
| |
|
||| |||| |
|
|
| T |
36753817 |
ccaatcat |
36753824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University