View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_277 (Length: 232)
Name: NF0928_low_277
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_277 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 46 - 232
Target Start/End: Complemental strand, 51005771 - 51005576
Alignment:
Q |
46 |
cttttaggaatttatctcctatatt---gtatgttaaaatttggattgatttatcgcttatggatattctttgcttcaaattgtatataggaagaaaata |
142 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51005771 |
cttttaggaatttatctcctatattattgtatgttaaaatttggattgatttatcgcttatggatattctttgcttcaaattgtatataggaagaaaata |
51005672 |
T |
 |
Q |
143 |
a----ataagtactatcttgtaaaactaggacatgggacatggcttctttaccaacaat--nnnnnnntagcacgacttttattttgatgggatat |
232 |
Q |
|
|
| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
51005671 |
aataaataagtactatcttgtaaaactaggacacgggacatggcttctttaccaacaataaaaaaaataagcacgacttttattttgatgggatat |
51005576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 51005856 - 51005805
Alignment:
Q |
1 |
agaaatttgtaattcattcaaggaagtataggcatatattctctgcttttag |
52 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51005856 |
agaaatttgtaattcattcaaggaagtataggcatatattctctgcttttag |
51005805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 38741827 - 38741859
Alignment:
Q |
1 |
agaaatttgtaattcattcaaggaagtataggc |
33 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |
|
|
T |
38741827 |
agaaatttgtagttcattcaaggaagtataggc |
38741859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University