View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_279 (Length: 228)

Name: NF0928_low_279
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_279
NF0928_low_279
[»] chr1 (2 HSPs)
chr1 (1-92)||(47320055-47320152)
chr1 (21-81)||(47311272-47311332)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 47320152 - 47320055
Alignment:
1 tgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgc------cgcttcatcaacttgaagttcatatttcaactct 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||    
47320152 tgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgccgctgccgcttcatcaacttgaagttcatatttcaactct 47320055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 81
Target Start/End: Complemental strand, 47311332 - 47311272
Alignment:
21 tgttattgttcgtcatctttctcttcatctttgagtgccgcttcatcaacttgaagttcat 81  Q
    ||||||| ||| |||| |||||  ||||||||||||||| || ||||| ||||||||||||    
47311332 tgttattcttcatcatttttctgctcatctttgagtgccactccatcaccttgaagttcat 47311272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University