View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_280 (Length: 228)

Name: NF0928_low_280
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_280
NF0928_low_280
[»] chr1 (2 HSPs)
chr1 (1-48)||(47320128-47320175)
chr1 (32-74)||(47320180-47320222)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 47320128 - 47320175
Alignment:
1 taacaagtttgactacaatcctgcatgtagcaattcctagtttgatct 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
47320128 taacaagtttgactacaatcctgcatgtagcaattcctagtttgatct 47320175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 74
Target Start/End: Original strand, 47320180 - 47320222
Alignment:
32 aattcctagtttgatctatctgttatgtgtcaatttcacagta 74  Q
    |||||||||||||||||||||||||||||||||||||||||||    
47320180 aattcctagtttgatctatctgttatgtgtcaatttcacagta 47320222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University