View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_281 (Length: 226)
Name: NF0928_low_281
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_281 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 35342167 - 35341946
Alignment:
Q |
1 |
tcgtcccttatggatcaacagaatttcgatcaaattatcatgtacaaaaacaagagcaagagcttgtttgtataatgtttcata-----tgatgtaaaat |
95 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
35342167 |
tcgtcccttatggatcaatagaatttcgatcaaattatcatgtacaaaaacaagagcaagagcttgtttgtataatgtttcatactgtatgatgtaaaat |
35342068 |
T |
 |
Q |
96 |
tgaatacggtgttaattacactataggctatgtcaatgtcacgatgttattattttgttgaaatgaaacgtatttgcagaccnnnnnnnctttccctcca |
195 |
Q |
|
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
T |
35342067 |
tgaatacggtgttaattagaccataggctatgtcaatgtcacgatgttattattttgttgaaatgaaacgtatttgctgacctttttttctttccctcca |
35341968 |
T |
 |
Q |
196 |
taagaggcattgccagtattat |
217 |
Q |
|
|
|||||||||||||||| ||||| |
|
|
T |
35341967 |
taagaggcattgccagcattat |
35341946 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University