View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_283 (Length: 221)
Name: NF0928_low_283
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_283 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 39300020 - 39299908
Alignment:
Q |
1 |
ttctctcatgattggcaagtcatttacagaatccttgtgtacgtatgaacaagatttttgtaccattggagctttatccaattgaccggggtatgacagg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39300020 |
ttctctcatgattggcaagtcatttacagaatccttgtgtacgtatgaacaagatttttgtaccattggagctttatccaattgaccggggtatgacagg |
39299921 |
T |
 |
Q |
101 |
catgggaagttct |
113 |
Q |
|
|
||||||||||||| |
|
|
T |
39299920 |
catgggaagttct |
39299908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 114 - 194
Target Start/End: Complemental strand, 39262343 - 39262263
Alignment:
Q |
114 |
aagcttgtatcggtcttgctcactcaacttgtccccttgttcatgtctcactcaacaaacacaccatataggcagttcttg |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
39262343 |
aagcttgtatcggtcttgctcactcaacttgtccccttgttcatgtctcactcaacaaacacaccatatgggcagttcttg |
39262263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1101 times since January 2019
Visitors: 6709