View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_283 (Length: 221)

Name: NF0928_low_283
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_283
NF0928_low_283
[»] chr7 (2 HSPs)
chr7 (1-113)||(39299908-39300020)
chr7 (114-194)||(39262263-39262343)


Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 39300020 - 39299908
Alignment:
1 ttctctcatgattggcaagtcatttacagaatccttgtgtacgtatgaacaagatttttgtaccattggagctttatccaattgaccggggtatgacagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39300020 ttctctcatgattggcaagtcatttacagaatccttgtgtacgtatgaacaagatttttgtaccattggagctttatccaattgaccggggtatgacagg 39299921  T
101 catgggaagttct 113  Q
    |||||||||||||    
39299920 catgggaagttct 39299908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 114 - 194
Target Start/End: Complemental strand, 39262343 - 39262263
Alignment:
114 aagcttgtatcggtcttgctcactcaacttgtccccttgttcatgtctcactcaacaaacacaccatataggcagttcttg 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39262343 aagcttgtatcggtcttgctcactcaacttgtccccttgttcatgtctcactcaacaaacacaccatatgggcagttcttg 39262263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1101 times since January 2019
Visitors: 6709