View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_285 (Length: 220)
Name: NF0928_low_285
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_285 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 34742918 - 34743125
Alignment:
| Q |
1 |
ggaggtctaccatcataagctaattgttgcactaagnnnnnnnnnctttctaaattccgattagttttgaagtacatttaacttaggcatgattgtagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34742918 |
ggaggtctaccatcataagctaattgttgcactaagcttttttttctttctaaattccgattagttttgaagtacatttaacttaggcatgattgtagtt |
34743017 |
T |
|
| Q |
101 |
ttggtgctctatttttactattttgtagaagtgattcgccaatttgataatctgacaatttggtccctccatcaacattatatgtacaattcttattcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34743018 |
ttggtgctctatttttactattttgtagaagtgattcgccaatttgataatctgacaatttggtccctccatcaacattatatgtacaattcttattcct |
34743117 |
T |
|
| Q |
201 |
gtgatatt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
34743118 |
gtgatatt |
34743125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 932 times since January 2019
Visitors: 6707