View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_290 (Length: 219)
Name: NF0928_low_290
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_290 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 42444260 - 42444050
Alignment:
Q |
1 |
gtaacactttttgctggctggcatggttatattatatatgtcatgattcatgtagtgtatatttattcttaagtcggcaacaatgattagtatttgtttt |
100 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
42444260 |
gtaacactttttgctggctagcatggttatattatatatgtcatgattcatgtggtgtatatttattcttaagtcggcaacaatgactagtatttgtttt |
42444161 |
T |
 |
Q |
101 |
taaaaggttgttgttgtcttgttgttcctacctaccatattctgtttagcttagtttgttgaaagattgcttcatggattcgtggatattttcttgagtt |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
42444160 |
taaaaggttgttgttgtcttgttgttcctacctaccatattctgtttagcttagttttttggaagattgcttcatggaatcgtggatattttcttgagtt |
42444061 |
T |
 |
Q |
201 |
ttaatctctgc |
211 |
Q |
|
|
||||||||||| |
|
|
T |
42444060 |
ttaatctctgc |
42444050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University