View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_293 (Length: 218)

Name: NF0928_low_293
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_293
NF0928_low_293
[»] chr4 (2 HSPs)
chr4 (1-60)||(55694313-55694372)
chr4 (154-218)||(55694483-55694546)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 55694313 - 55694372
Alignment:
1 ttaatttctgtcagtgacatgaggtgtctgcttgaaaaagattcttccaagtggccacag 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55694313 ttaatttctgtcagtgacatgaggtgtctgcttgaaaaagattcttccaagtggccacag 55694372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 218
Target Start/End: Original strand, 55694483 - 55694546
Alignment:
154 atttcttttgtaattcatctttccattcccaaatggccactgttgaggtaattcaaagatatagt 218  Q
    |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||    
55694483 atttcttttgtaattcctctttccattcc-aaatggccactgttgaggtaattcaaagatatagt 55694546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University