View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_295 (Length: 216)

Name: NF0928_low_295
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_295
NF0928_low_295
[»] chr1 (1 HSPs)
chr1 (10-121)||(36753713-36753824)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 36753824 - 36753713
Alignment:
10 atgaatggtagtctttcgtgaaagtcagggatgtgtcacttttcttcttgttggcactggtagtggtagtagtatataattccctcattttcacgtagct 109  Q
    |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||    
36753824 atgattggcagtctttcgtgaaagtcagggatgtgtcacttttcttcttgttggcactggtagtagtagtagtaaataattccctcattttcacgtagct 36753725  T
110 atgctttaacac 121  Q
    ||||||||||||    
36753724 atgctttaacac 36753713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 814 times since January 2019
Visitors: 6705