View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_295 (Length: 216)
Name: NF0928_low_295
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_295 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 36753824 - 36753713
Alignment:
Q |
10 |
atgaatggtagtctttcgtgaaagtcagggatgtgtcacttttcttcttgttggcactggtagtggtagtagtatataattccctcattttcacgtagct |
109 |
Q |
|
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
T |
36753824 |
atgattggcagtctttcgtgaaagtcagggatgtgtcacttttcttcttgttggcactggtagtagtagtagtaaataattccctcattttcacgtagct |
36753725 |
T |
 |
Q |
110 |
atgctttaacac |
121 |
Q |
|
|
|||||||||||| |
|
|
T |
36753724 |
atgctttaacac |
36753713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University