View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_298 (Length: 214)

Name: NF0928_low_298
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_298
NF0928_low_298
[»] chr1 (1 HSPs)
chr1 (5-47)||(31052642-31052684)


Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 31052642 - 31052684
Alignment:
5 agcatataatataacatatatttaggccaatttttatcttatt 47  Q
    |||||||||||||||||||||||||||||| ||||||||||||    
31052642 agcatataatataacatatatttaggccaaattttatcttatt 31052684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University