View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_299 (Length: 214)

Name: NF0928_low_299
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_299
NF0928_low_299
[»] chr1 (1 HSPs)
chr1 (1-133)||(43947621-43947753)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 43947621 - 43947753
Alignment:
1 aattgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43947621 aattgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagttt 43947720  T
101 gtttatttaagtgggattgtatgatattgttgg 133  Q
    ||||||||||||||||||||||||||| |||||    
43947721 gtttatttaagtgggattgtatgatatggttgg 43947753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 90 times since January 2019
Visitors: 6713