View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_300 (Length: 214)
Name: NF0928_low_300
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_300 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 8888134 - 8888016
Alignment:
Q |
1 |
ttagatgtttgtactatttatctatatcaattgagtgtgtattcaacttttggagggtaggttcattatacctgtgttgattattgatattcaccatctt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8888134 |
ttagatgtttgtactatttatctatatcaattgagtgtgtattcaacttttggagggtaggttcattatacctgtgttgattattgatattcaccatctt |
8888035 |
T |
 |
Q |
101 |
ttttgattgatcatgccaa |
119 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
8888034 |
ttttgattgatcatgccaa |
8888016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 412 times since January 2019
Visitors: 6714