View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_303 (Length: 208)
Name: NF0928_low_303
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_303 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 43947621 - 43947753
Alignment:
Q |
1 |
aattgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43947621 |
aattgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagttt |
43947720 |
T |
 |
Q |
101 |
gtttatttaagtgggattgtatgatattgttgg |
133 |
Q |
|
|
||||||||||||||||||||||||||| ||||| |
|
|
T |
43947721 |
gtttatttaagtgggattgtatgatatggttgg |
43947753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University