View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_308 (Length: 203)
Name: NF0928_low_308
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_308 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 43194166 - 43193964
Alignment:
Q |
1 |
tgaatcggttgatgacctaaccaatgattatatctaaactgaagtttgttaaatatttgatgttattaaaattannnnnnnnnnnnnaattgatatttga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||| |
|
|
T |
43194166 |
tgaatcggttgatgacctaaccaatgattatatctaaactgaagtctgttaaatatttgatgttattaaaattatttttatttttttaattgagatttga |
43194067 |
T |
 |
Q |
101 |
tttggttcttggtgttgatgatgctgtctaataatttgagattgaatcgttcagatgagttaaaaaagtttgttttggctagattatctgaaagttttga |
200 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43194066 |
tttggttcttggtgttaatgatgctgtctaataatttgagattgaatcgttcagatgagttaaaaaagtttgttttggctagattatctgaaagttttga |
43193967 |
T |
 |
Q |
201 |
tct |
203 |
Q |
|
|
||| |
|
|
T |
43193966 |
tct |
43193964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University