View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_309 (Length: 202)
Name: NF0928_low_309
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_309 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 3829482 - 3829361
Alignment:
| Q |
1 |
taaccacacaccgtaaatccacaatcacaataacaaataaaaagtaggaattgaaaatgagaaaatcttacgacacttttaaaatatgaagtcgttacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3829482 |
taaccacacaccgtaaatccacaatcacaataataaataaaaagtaggaattaaaaatgagaaaatcttacgacacttttaaaatatgaagtcgttacaa |
3829383 |
T |
 |
| Q |
101 |
gagcaattataatcctatgata |
122 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
3829382 |
gagcaattataatcctttgata |
3829361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University