View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_309 (Length: 202)

Name: NF0928_low_309
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_309
NF0928_low_309
[»] chr2 (1 HSPs)
chr2 (1-122)||(3829361-3829482)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 3829482 - 3829361
Alignment:
1 taaccacacaccgtaaatccacaatcacaataacaaataaaaagtaggaattgaaaatgagaaaatcttacgacacttttaaaatatgaagtcgttacaa 100  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
3829482 taaccacacaccgtaaatccacaatcacaataataaataaaaagtaggaattaaaaatgagaaaatcttacgacacttttaaaatatgaagtcgttacaa 3829383  T
101 gagcaattataatcctatgata 122  Q
    |||||||||||||||| |||||    
3829382 gagcaattataatcctttgata 3829361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University