View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_311 (Length: 201)
Name: NF0928_low_311
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0928_low_311 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 22 - 151
Target Start/End: Original strand, 45936969 - 45937098
Alignment:
Q |
22 |
cttatcatcacagcttttattagctgggcttttcttcgggagaaattatatgttggaacgtaagcaatttaattgattaattagttcataattacatata |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45936969 |
cttatcatcacagcttttattagctgggcttttcttcgggagaaattatatgttggaacgtaagcaatttaattgattaattagttcataattacatata |
45937068 |
T |
 |
Q |
122 |
attatatttagtagtactaattatggtcta |
151 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
45937069 |
attatatttagtagtactaattatggtcta |
45937098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 10562550 - 10562608
Alignment:
Q |
22 |
cttatcatcacagcttttattagctgggcttttcttcgggagaaattatatgttggaac |
80 |
Q |
|
|
|||||| |||||||||||||||||||||||||| ||| |||||||||||| |||||||| |
|
|
T |
10562550 |
cttatcctcacagcttttattagctgggcttttattcaggagaaattatacgttggaac |
10562608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University