View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_46 (Length: 487)
Name: NF0928_low_46
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 3e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 30 - 255
Target Start/End: Original strand, 29340635 - 29340854
Alignment:
| Q |
30 |
gtttccatttacatgatcacagaaatggcatggcacgtgacaaagagagacttttccttttggtcatggcagcaagagacaagtccatgtttccgtagtt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29340635 |
gtttccatttacatgatcacagaaatggcatggcacgtgacaaagcgaggctcttccttttggtcatggcagcaagagacaggtccatgtttccgtagtt |
29340734 |
T |
|
| Q |
130 |
tagtgcagttcccatgaccccgctctcacttcacttcctcattataatattgcttaaatgccttgcataatcagcataagcattatatgttaaagcggaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| || ||| |
|
|
| T |
29340735 |
tagtgcagttcccatgaccccgctctcacttcacttcctcattataatattgtttaaatgccttgcataatcatcataagcattatat------gcagaa |
29340828 |
T |
|
| Q |
230 |
gttagcttgattgattcatgatctat |
255 |
Q |
| |
|
||||||||| ||||| |||||||||| |
|
|
| T |
29340829 |
gttagcttggttgatccatgatctat |
29340854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 651 times since January 2019
Visitors: 6718