View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_68 (Length: 423)
Name: NF0928_low_68
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 9e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 54 - 187
Target Start/End: Original strand, 15638743 - 15638874
Alignment:
| Q |
54 |
gatttgaagaaatgattgatagtcaaagaatccattgaaaaacaa--ttaagaaaatgcatttataagtttcttcctatcttttatcatccgtttatatg |
151 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15638743 |
gatttgaaaaaatgattgttagtcaaagaacccattgaaaaaaaaaattaagaaaatgcatttataagtttcttcctgtcttttatcatccgtttat--- |
15638839 |
T |
|
| Q |
152 |
aatgaattggtagtagtcaaagtatattagcataaa |
187 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15638840 |
-atgaattagtagtagtcaaagtatattagcataaa |
15638874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 244 - 318
Target Start/End: Complemental strand, 48047566 - 48047492
Alignment:
| Q |
244 |
ttaaagcatttt-tggcttcagttctagctaaaaaaccaagctcgtgataatgttttgatactatgaaaatcaaca |
318 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| |||||| | ||| |||||||||||||||| |||| ||||| |
|
|
| T |
48047566 |
ttaaagcatgttctggcttcagttctagctaaaaa-ccaagcccatgacaatgttttgatactataaaaaacaaca |
48047492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1022 times since January 2019
Visitors: 6708