View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_73 (Length: 418)
Name: NF0928_low_73
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 29 - 409
Target Start/End: Original strand, 12669966 - 12670346
Alignment:
| Q |
29 |
accatggtggtcatgaacttgctcctactagtactcatcacatgcatgagattttccttattgggacctgtatcatatgaatcatactcttaattagtga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12669966 |
accatggtggtcatgaacttgctcctactagtactcatcacatgcatgagattttccttattgggacctgtatcatatgaatcatactcttaattagtga |
12670065 |
T |
|
| Q |
129 |
ttgcagagaatgaagaaagaatggcaggagcagtactagccagctttagatttataaatagaaattttatgtatattattataatataaagtaaagtttt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12670066 |
ttgcagagaatgaagaaagaatggcaggagcagtactagccagctttagatttataaatagaaattttatgtatattattataatataaagtaaggtttt |
12670165 |
T |
|
| Q |
229 |
tcagatgatcaaagtaaaatatagaaaaagctagtatataaagatatgcctttaacattaatttagcatatgaaaaaggttttgagctatgactatatga |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12670166 |
tcagatgatcaaagtaaaatatagaaaaagctagtatataaagatatgcctttaacattaatttagcatatgaaaaaggttttgagctatgactatatga |
12670265 |
T |
|
| Q |
329 |
tgaaagtaaaatgattatggagatttccacattgaacaagtctagtagtacctttgacaaatttgtcttttggtttcatct |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12670266 |
tgaaagtaaaatgattatggagatttccacattgaacaagtctagtagtacctttgacaaatttgtcttttggtttcatct |
12670346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 137 times since January 2019
Visitors: 6702