View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0928_low_87 (Length: 392)
Name: NF0928_low_87
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0928_low_87 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 214 - 363
Target Start/End: Complemental strand, 2453250 - 2453101
Alignment:
| Q |
214 |
tttgggtccgtcactacctcaaatgatcaaacaaccaaaccctaagaaacacaaaaaacatgatctagtaaaatggtacgatttatggctaaatcaatag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2453250 |
tttgggtccgtcactacctcaaatgatcaaacaaccaaaccctaagaaacacaaaaaacatgatctagtaaaatggtacgatttatggctaaatcaatag |
2453151 |
T |
 |
| Q |
314 |
attagtgataacttcaccatcatgaatacagaccatgcatataatgcatg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2453150 |
attagtgataacttcaccatcatgaatagagaccatgcatataatgcatg |
2453101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 2453443 - 2453326
Alignment:
| Q |
8 |
ccaacaatatgcaacttaaaatttatgctcactgctaatttattttgggaaatgaaaaattagtattaaaacatactccatcgggtcgtaattataagaa |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2453443 |
ccaacaaaatgcaacttaaaatttatgctcactgctaaattatattgggagatgaaaaattagtattaaaacatactccatcgggtcgtaattataagaa |
2453344 |
T |
 |
| Q |
108 |
tgatcattcggtcatttt |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2453343 |
tgatcattcggtcatttt |
2453326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University