View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_high_12 (Length: 314)
Name: NF0929_high_12
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0929_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 11109839 - 11109603
Alignment:
| Q |
1 |
tgaaaattaactagcaatgacactattaatctttggcaaatatgacaattattaaattaacaag----ggcctagaacaaaggttttagtagtcttacct |
96 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11109839 |
tgaaaattaactagtaatgacactattaatctttggcaaatatgacaattattaaattaacaagaaagggcctaga-caaaggttttagtagtcttacct |
11109741 |
T |
|
| Q |
97 |
ttagaccaaccctacatatattgttggttagtgttannnnnnnagagccaaaaaataataataaggaagtacatgcataagaaatgtattgcccataaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11109740 |
ttagaccaaccctacatatattgttggttagtgttatttttttagagccaaaaaataataataaggaagtacatgcataagaaatgtattgcccataaat |
11109641 |
T |
|
| Q |
197 |
cgaatttagtcaactccttttatggttatgtatgcact |
234 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11109640 |
cgaattcagtcaactccttttatggttatgtatgcact |
11109603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1275 times since January 2019
Visitors: 6712