View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0929_high_12 (Length: 314)

Name: NF0929_high_12
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0929_high_12
NF0929_high_12
[»] chr2 (1 HSPs)
chr2 (1-234)||(11109603-11109839)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 11109839 - 11109603
Alignment:
1 tgaaaattaactagcaatgacactattaatctttggcaaatatgacaattattaaattaacaag----ggcctagaacaaaggttttagtagtcttacct 96  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    |||||||| |||||||||||||||||||||||    
11109839 tgaaaattaactagtaatgacactattaatctttggcaaatatgacaattattaaattaacaagaaagggcctaga-caaaggttttagtagtcttacct 11109741  T
97 ttagaccaaccctacatatattgttggttagtgttannnnnnnagagccaaaaaataataataaggaagtacatgcataagaaatgtattgcccataaat 196  Q
    ||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11109740 ttagaccaaccctacatatattgttggttagtgttatttttttagagccaaaaaataataataaggaagtacatgcataagaaatgtattgcccataaat 11109641  T
197 cgaatttagtcaactccttttatggttatgtatgcact 234  Q
    |||||| |||||||||||||||||||||||||||||||    
11109640 cgaattcagtcaactccttttatggttatgtatgcact 11109603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1275 times since January 2019
Visitors: 6712