View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0929_high_4 (Length: 359)

Name: NF0929_high_4
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0929_high_4
NF0929_high_4
[»] chr8 (1 HSPs)
chr8 (13-75)||(454724-454786)


Alignment Details
Target: chr8 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 454786 - 454724
Alignment:
13 aatatcccatctttactttccaaaatacgactcttatttgtgaatatgaagagatggagaaaa 75  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
454786 aatatcccatctttactttccaaaatacgactcttatttgtgaatatgaagagatggagaaaa 454724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University