View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_14 (Length: 361)
Name: NF0929_low_14
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0929_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 104 - 337
Target Start/End: Original strand, 43148592 - 43148825
Alignment:
Q |
104 |
gttctttcaactacatagcagccattcatttcctttcagctacatacataactaccatcccttttcaaccctctgtctatgttacatgtttctttaattt |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43148592 |
gttctttcaactacatagcagccattcatttcctttcagctacatacataaccaccatcccttttcaaccctctgtctatgttacatgtttctttaattt |
43148691 |
T |
 |
Q |
204 |
aaggtgtttatcatttatgtgctgtcgacttttggttggatgtgcccatatgttactccttcttgggttattattgcgaataaacacgtgacaccttgca |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43148692 |
aaggtgtttatcatttatgtgctgtcgacttttggttggatgtgcccatatgttactccttcttgggttattattgcgaataaacacgtgacaccttgca |
43148791 |
T |
 |
Q |
304 |
tgcatgctgtcattcttcaatcttctctgctgct |
337 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
43148792 |
tgcatgctgtcattcttcaatcttctctcctgct |
43148825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University