View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_34 (Length: 291)
Name: NF0929_low_34
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0929_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 99 - 204
Target Start/End: Original strand, 25495700 - 25495805
Alignment:
Q |
99 |
ggaatggttttagaaagggaatctgaaatcatcttcgcgctactcaggctagtgtgaagagttaaaaactgatcaattgtatgttgagggttatgttcct |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25495700 |
ggaatggttttagaaagggaatctgaaatcatcttcgcgctactcaggctagtgtgaagagttaaaaactgatcaattgtatgttgagggttatgttcct |
25495799 |
T |
 |
Q |
199 |
tggcag |
204 |
Q |
|
|
|||||| |
|
|
T |
25495800 |
tggcag |
25495805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University