View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_41 (Length: 273)
Name: NF0929_low_41
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0929_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 23 - 240
Target Start/End: Original strand, 29023701 - 29023918
Alignment:
| Q |
23 |
ccaacaatagaaccatgacctatactagatgtctgatcagggattgattctggctctatgcttttggtcctttgaagactaggactacgatgaagcctac |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29023701 |
ccaacaatagaaccatgacctatagtagatgtctgatcagggattgattctggctctatgcttttggtcctttgaagactaggactacgatgaagcctac |
29023800 |
T |
|
| Q |
123 |
aacgaaatgaaccaggatgtgttgttggtgaacatagacaatttgttttagtcatactaggttgtctcataagtccaccttgtcccatatttgaacctcc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29023801 |
aacgaaatgaaccaggatgtgttgttggtgaacatagacaatttgttttggtcatactaggttgtctcataagtccaccttgtcccatatttgaaccccc |
29023900 |
T |
|
| Q |
223 |
ttgtacctctacccctat |
240 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29023901 |
ttgtacctctacccctat |
29023918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 98 - 205
Target Start/End: Original strand, 14133921 - 14134028
Alignment:
| Q |
98 |
agactaggactacgatgaagcctacaacgaaatgaaccaggatgtgttgttggtgaacatagacaatttgttttagtcatactaggttgtctcataagtc |
197 |
Q |
| |
|
|||||||| ||||||| |||||||| | |||||| |||| |||||||||||| || |||| |||||| | || ||||||| | |||||||| ||| | |
|
|
| T |
14133921 |
agactaggtgtacgatgtagcctacacctaaatgatccagcatgtgttgttggagagcataaacaattgttcttgttcatacttgcttgtctcaaaagac |
14134020 |
T |
|
| Q |
198 |
caccttgt |
205 |
Q |
| |
|
|||||||| |
|
|
| T |
14134021 |
caccttgt |
14134028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 188 times since January 2019
Visitors: 6702