View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_43 (Length: 263)
Name: NF0929_low_43
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0929_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 41 - 238
Target Start/End: Complemental strand, 52049664 - 52049469
Alignment:
| Q |
41 |
aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgctgctttaggagcaaactttaaattagttcaagtaaa-taaataataaaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52049664 |
aaagcttgcgccactcaatattgataaaaggtttattggttaccctgctgct---ttaggagcaaactttaaattagttcaagtaaaataaataataaaa |
52049568 |
T |
|
| Q |
140 |
atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgcct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52049567 |
atgaggaaaatctatacatacgtaggtttataatgcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggcctgcct |
52049469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1470 times since January 2019
Visitors: 6712