View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_46 (Length: 254)
Name: NF0929_low_46
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0929_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 8322524 - 8322723
Alignment:
| Q |
1 |
ttagcactgctgataataattttaattggaagacaatattaagtagagttattagatgcataatctcgtatagtgtggcattaagtttgcattaataata |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8322524 |
ttagtactgctgataataattttaattggaagacaatattaagtagagtta---gatgcataatctcgtataatgtggcattaagtttgcattaataata |
8322620 |
T |
 |
| Q |
101 |
tggaataactgtgcaaacaaaaatctcatgtagtgaaacattttggcctacaataaacaattaacattaatatgtaagaaaaattattgtttaacgttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8322621 |
tggaataactgtgcaaacaaaaatctcatgtagtgaaacattttggcctacaataatcaattaacattaatatgtaagaaaaattattgtttaacgttga |
8322720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University