View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0929_low_48 (Length: 251)

Name: NF0929_low_48
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0929_low_48
NF0929_low_48
[»] chr7 (17 HSPs)
chr7 (35-147)||(21681933-21682042)
chr7 (33-147)||(21714466-21714577)
chr7 (35-147)||(21785689-21785798)
chr7 (35-147)||(21652352-21652461)
chr7 (35-147)||(21772244-21772353)
chr7 (50-147)||(21992465-21992562)
chr7 (50-146)||(21623477-21623573)
chr7 (50-147)||(21788512-21788609)
chr7 (50-147)||(21647026-21647127)
chr7 (93-148)||(15713905-15713960)
chr7 (35-147)||(21689696-21689805)
chr7 (86-147)||(21726179-21726240)
chr7 (86-147)||(21792294-21792355)
chr7 (87-147)||(21807970-21808030)
chr7 (101-147)||(21764345-21764391)
chr7 (86-147)||(21628408-21628469)
chr7 (93-147)||(21745815-21745869)
[»] scaffold0182 (1 HSPs)
scaffold0182 (34-147)||(25656-25766)
[»] chr1 (1 HSPs)
chr1 (103-147)||(18192060-18192104)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 17)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21682042 - 21681933
Alignment:
35 agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg 134  Q
    |||||||||||||||   | |||||| ||||||||||||||||||||||  |||||| ||||||||||||||||||||||||||||||||||||||||||    
21682042 agttgatcaacctta---acattcatgtgccctggttcataaagcatggttttctccaagatatgtagcaaagaacatccatccacgaacaacatccatg 21681946  T
135 ataacttttcttc 147  Q
    |||||||||||||    
21681945 ataacttttcttc 21681933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 33 - 147
Target Start/End: Complemental strand, 21714577 - 21714466
Alignment:
33 caagttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatcca 132  Q
    ||||||||||||||||    |||||||||||||||||||||| |||| ||||  ||||| ||||||| ||||||||||||||||||||||||||||||||    
21714577 caagttgatcaaccttg---atattcatttgccctggttcatcaagcttggctctctccaagatatgaagcaaagaacatccatccacgaacaacatcca 21714481  T
133 tgataacttttcttc 147  Q
     |||| |||||||||    
21714480 cgatagcttttcttc 21714466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21785798 - 21785689
Alignment:
35 agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg 134  Q
    |||||||||||||||   |||||||||||||||||| ||| |||| |||| |||||| |||||||||||||||||||||||||||| ||||||||||| |    
21785798 agttgatcaacctta---atattcatttgccctggtacatgaagcttggctttctccaagatatgtagcaaagaacatccatccacaaacaacatccacg 21785702  T
135 ataacttttcttc 147  Q
    | | |||||||||    
21785701 acagcttttcttc 21785689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21652461 - 21652352
Alignment:
35 agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg 134  Q
    |||||||||||||||   |||||||| ||||||| ||||| ||   |||| |||||| ||||||| ||||| |||||||||||||||||||||||||| |    
21652461 agttgatcaacctta---atattcatgtgccctgcttcatcaacgttggctttctccaagatatgcagcaacgaacatccatccacgaacaacatccacg 21652365  T
135 ataacttttcttc 147  Q
    | |||||||||||    
21652364 acaacttttcttc 21652352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21772353 - 21772244
Alignment:
35 agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg 134  Q
    |||||||||||||||   |||||||| |||| |||||||| |||  | || |||||| ||||||  |||||||||||||||||||||||||||||||| |    
21772353 agttgatcaacctta---atattcatgtgccatggttcattaagattcgctttctccaagatatacagcaaagaacatccatccacgaacaacatccacg 21772257  T
135 ataacttttcttc 147  Q
    | |||||||||||    
21772256 acaacttttcttc 21772244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 50 - 147
Target Start/End: Complemental strand, 21992562 - 21992465
Alignment:
50 ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    ||||||||||| ||||| ||||||| |||| |||| |||||  ||||||  | ||||||||||||||||||||||||||||||||| | |||||||||    
21992562 ttaatattcatgtgcccaggttcatcaagcttggctttctctaagatatacaacaaagaacatccatccacgaacaacatccatgacagcttttcttc 21992465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 50 - 146
Target Start/End: Complemental strand, 21623573 - 21623477
Alignment:
50 ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttctt 146  Q
    ||||||||||| ||||||||||||| |||| ||||  | |||  |||||| |||||||||||||||||||||||||||||||| || | ||||||||    
21623573 ttaatattcatctgccctggttcatgaagcttggctgtatccatgatatgcagcaaagaacatccatccacgaacaacatccacgacagcttttctt 21623477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 50 - 147
Target Start/End: Complemental strand, 21788609 - 21788512
Alignment:
50 ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    ||||||||||| ||||| ||||||| |||| |||| |||||  ||||||  | |||||||||||||||||||||||||||||| || | |||||||||    
21788609 ttaatattcatgtgcccaggttcatcaagcttggctttctctaagatatacaacaaagaacatccatccacgaacaacatccacgacagcttttcttc 21788512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 50 - 147
Target Start/End: Complemental strand, 21647127 - 21647026
Alignment:
50 ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatcc----atccacgaacaacatccatgataacttttct 145  Q
    ||||||||||| ||||||||||||| |||| |||| |||||  ||||||| ||||||||||||||    |||||||||||| ||||| || |||||||||    
21647127 ttaatattcatctgccctggttcatgaagcttggctttctctaagatatgcagcaaagaacatccatatatccacgaacaatatccacgacaacttttct 21647028  T
146 tc 147  Q
    ||    
21647027 tc 21647026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 93 - 148
Target Start/End: Complemental strand, 15713960 - 15713905
Alignment:
93 agatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttct 148  Q
    ||||||| |||||||| |||||||||||||||||||||||||| | ||||||||||    
15713960 agatatgcagcaaagagcatccatccacgaacaacatccatgacagcttttcttct 15713905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21689805 - 21689696
Alignment:
35 agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg 134  Q
    |||||||||||||||   |||| |||  |||||||||||  |||| || | |||||| ||||||  |||||||| ||||||||||| ||||||||||| |    
21689805 agttgatcaacctta---atatccataggccctggttcaacaagcctgtctttctccaagatataaagcaaagagcatccatccaccaacaacatccacg 21689709  T
135 ataacttttcttc 147  Q
    ||| |||||||||    
21689708 atagcttttcttc 21689696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 86 - 147
Target Start/End: Complemental strand, 21726240 - 21726179
Alignment:
86 ttctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    |||||| ||||||  |||||||||||||||||||||||||||||||| || | |||||||||    
21726240 ttctccaagatatacagcaaagaacatccatccacgaacaacatccacgacagcttttcttc 21726179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 86 - 147
Target Start/End: Complemental strand, 21792355 - 21792294
Alignment:
86 ttctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    |||||| ||||||| | |||||||||||||||||||||||| |||||||| | |||||||||    
21792355 ttctccaagatatgcaacaaagaacatccatccacgaacaatatccatgacagcttttcttc 21792294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 87 - 147
Target Start/End: Original strand, 21807970 - 21808030
Alignment:
87 tctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    ||||| ||||||  |||||||| |||||||||||||||||||||||||| | |||||||||    
21807970 tctccaagatataaagcaaagagcatccatccacgaacaacatccatgacagcttttcttc 21808030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 147
Target Start/End: Complemental strand, 21764391 - 21764345
Alignment:
101 agcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    |||||||| ||||||||||||||||||||||| || |||||||||||    
21764391 agcaaagagcatccatccacgaacaacatccacgacaacttttcttc 21764345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 86 - 147
Target Start/End: Complemental strand, 21628469 - 21628408
Alignment:
86 ttctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    |||||| ||||||  |||||||| ||||||||||||||||||||||| || | |||||||||    
21628469 ttctccaagatataaagcaaagagcatccatccacgaacaacatccacgacagcttttcttc 21628408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 147
Target Start/End: Complemental strand, 21745869 - 21745815
Alignment:
93 agatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    ||||||| ||||||||||||||||| ||||| |||||||| || | |||||||||    
21745869 agatatggagcaaagaacatccatctacgaataacatccacgacagcttttcttc 21745815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0182 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0182
Description:

Target: scaffold0182; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 34 - 147
Target Start/End: Complemental strand, 25766 - 25656
Alignment:
34 aagttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccat 133  Q
    ||||||||||||||||   |||||||||| |||||| | || | |  ||||||||||| |||||||||||||||||||||||||||||||||||||| |     
25766 aagttgatcaacctta---atattcattttccctgggttattacgtctggcattctccaagatatgtagcaaagaacatccatccacgaacaacatcaac 25670  T
134 gataacttttcttc 147  Q
    || | |||||||||    
25669 gacagcttttcttc 25656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 103 - 147
Target Start/End: Original strand, 18192060 - 18192104
Alignment:
103 caaagaacatccatccacgaacaacatccatgataacttttcttc 147  Q
    |||||||||||||||||| |||||||||||||||| |||||||||    
18192060 caaagaacatccatccacaaacaacatccatgatagcttttcttc 18192104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University