View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_48 (Length: 251)
Name: NF0929_low_48
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0929_low_48 |
 |  |
|
[»] scaffold0182 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 17)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21682042 - 21681933
Alignment:
Q |
35 |
agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg |
134 |
Q |
|
|
||||||||||||||| | |||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21682042 |
agttgatcaacctta---acattcatgtgccctggttcataaagcatggttttctccaagatatgtagcaaagaacatccatccacgaacaacatccatg |
21681946 |
T |
 |
Q |
135 |
ataacttttcttc |
147 |
Q |
|
|
||||||||||||| |
|
|
T |
21681945 |
ataacttttcttc |
21681933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 33 - 147
Target Start/End: Complemental strand, 21714577 - 21714466
Alignment:
Q |
33 |
caagttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatcca |
132 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||| |||| |||| ||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
21714577 |
caagttgatcaaccttg---atattcatttgccctggttcatcaagcttggctctctccaagatatgaagcaaagaacatccatccacgaacaacatcca |
21714481 |
T |
 |
Q |
133 |
tgataacttttcttc |
147 |
Q |
|
|
|||| ||||||||| |
|
|
T |
21714480 |
cgatagcttttcttc |
21714466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21785798 - 21785689
Alignment:
Q |
35 |
agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg |
134 |
Q |
|
|
||||||||||||||| |||||||||||||||||| ||| |||| |||| |||||| |||||||||||||||||||||||||||| ||||||||||| | |
|
|
T |
21785798 |
agttgatcaacctta---atattcatttgccctggtacatgaagcttggctttctccaagatatgtagcaaagaacatccatccacaaacaacatccacg |
21785702 |
T |
 |
Q |
135 |
ataacttttcttc |
147 |
Q |
|
|
| | ||||||||| |
|
|
T |
21785701 |
acagcttttcttc |
21785689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21652461 - 21652352
Alignment:
Q |
35 |
agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg |
134 |
Q |
|
|
||||||||||||||| |||||||| ||||||| ||||| || |||| |||||| ||||||| ||||| |||||||||||||||||||||||||| | |
|
|
T |
21652461 |
agttgatcaacctta---atattcatgtgccctgcttcatcaacgttggctttctccaagatatgcagcaacgaacatccatccacgaacaacatccacg |
21652365 |
T |
 |
Q |
135 |
ataacttttcttc |
147 |
Q |
|
|
| ||||||||||| |
|
|
T |
21652364 |
acaacttttcttc |
21652352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21772353 - 21772244
Alignment:
Q |
35 |
agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg |
134 |
Q |
|
|
||||||||||||||| |||||||| |||| |||||||| ||| | || |||||| |||||| |||||||||||||||||||||||||||||||| | |
|
|
T |
21772353 |
agttgatcaacctta---atattcatgtgccatggttcattaagattcgctttctccaagatatacagcaaagaacatccatccacgaacaacatccacg |
21772257 |
T |
 |
Q |
135 |
ataacttttcttc |
147 |
Q |
|
|
| ||||||||||| |
|
|
T |
21772256 |
acaacttttcttc |
21772244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 50 - 147
Target Start/End: Complemental strand, 21992562 - 21992465
Alignment:
Q |
50 |
ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
||||||||||| ||||| ||||||| |||| |||| ||||| |||||| | ||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
T |
21992562 |
ttaatattcatgtgcccaggttcatcaagcttggctttctctaagatatacaacaaagaacatccatccacgaacaacatccatgacagcttttcttc |
21992465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 50 - 146
Target Start/End: Complemental strand, 21623573 - 21623477
Alignment:
Q |
50 |
ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttctt |
146 |
Q |
|
|
||||||||||| ||||||||||||| |||| |||| | ||| |||||| |||||||||||||||||||||||||||||||| || | |||||||| |
|
|
T |
21623573 |
ttaatattcatctgccctggttcatgaagcttggctgtatccatgatatgcagcaaagaacatccatccacgaacaacatccacgacagcttttctt |
21623477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 50 - 147
Target Start/End: Complemental strand, 21788609 - 21788512
Alignment:
Q |
50 |
ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
||||||||||| ||||| ||||||| |||| |||| ||||| |||||| | |||||||||||||||||||||||||||||| || | ||||||||| |
|
|
T |
21788609 |
ttaatattcatgtgcccaggttcatcaagcttggctttctctaagatatacaacaaagaacatccatccacgaacaacatccacgacagcttttcttc |
21788512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 50 - 147
Target Start/End: Complemental strand, 21647127 - 21647026
Alignment:
Q |
50 |
ttaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatcc----atccacgaacaacatccatgataacttttct |
145 |
Q |
|
|
||||||||||| ||||||||||||| |||| |||| ||||| ||||||| |||||||||||||| |||||||||||| ||||| || ||||||||| |
|
|
T |
21647127 |
ttaatattcatctgccctggttcatgaagcttggctttctctaagatatgcagcaaagaacatccatatatccacgaacaatatccacgacaacttttct |
21647028 |
T |
 |
Q |
146 |
tc |
147 |
Q |
|
|
|| |
|
|
T |
21647027 |
tc |
21647026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 93 - 148
Target Start/End: Complemental strand, 15713960 - 15713905
Alignment:
Q |
93 |
agatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttct |
148 |
Q |
|
|
||||||| |||||||| |||||||||||||||||||||||||| | |||||||||| |
|
|
T |
15713960 |
agatatgcagcaaagagcatccatccacgaacaacatccatgacagcttttcttct |
15713905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 35 - 147
Target Start/End: Complemental strand, 21689805 - 21689696
Alignment:
Q |
35 |
agttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccatg |
134 |
Q |
|
|
||||||||||||||| |||| ||| ||||||||||| |||| || | |||||| |||||| |||||||| ||||||||||| ||||||||||| | |
|
|
T |
21689805 |
agttgatcaacctta---atatccataggccctggttcaacaagcctgtctttctccaagatataaagcaaagagcatccatccaccaacaacatccacg |
21689709 |
T |
 |
Q |
135 |
ataacttttcttc |
147 |
Q |
|
|
||| ||||||||| |
|
|
T |
21689708 |
atagcttttcttc |
21689696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 86 - 147
Target Start/End: Complemental strand, 21726240 - 21726179
Alignment:
Q |
86 |
ttctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
|||||| |||||| |||||||||||||||||||||||||||||||| || | ||||||||| |
|
|
T |
21726240 |
ttctccaagatatacagcaaagaacatccatccacgaacaacatccacgacagcttttcttc |
21726179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 86 - 147
Target Start/End: Complemental strand, 21792355 - 21792294
Alignment:
Q |
86 |
ttctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
|||||| ||||||| | |||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
T |
21792355 |
ttctccaagatatgcaacaaagaacatccatccacgaacaatatccatgacagcttttcttc |
21792294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 87 - 147
Target Start/End: Original strand, 21807970 - 21808030
Alignment:
Q |
87 |
tctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
||||| |||||| |||||||| |||||||||||||||||||||||||| | ||||||||| |
|
|
T |
21807970 |
tctccaagatataaagcaaagagcatccatccacgaacaacatccatgacagcttttcttc |
21808030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 147
Target Start/End: Complemental strand, 21764391 - 21764345
Alignment:
Q |
101 |
agcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
|||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
T |
21764391 |
agcaaagagcatccatccacgaacaacatccacgacaacttttcttc |
21764345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 86 - 147
Target Start/End: Complemental strand, 21628469 - 21628408
Alignment:
Q |
86 |
ttctccgagatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
|||||| |||||| |||||||| ||||||||||||||||||||||| || | ||||||||| |
|
|
T |
21628469 |
ttctccaagatataaagcaaagagcatccatccacgaacaacatccacgacagcttttcttc |
21628408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 147
Target Start/End: Complemental strand, 21745869 - 21745815
Alignment:
Q |
93 |
agatatgtagcaaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
||||||| ||||||||||||||||| ||||| |||||||| || | ||||||||| |
|
|
T |
21745869 |
agatatggagcaaagaacatccatctacgaataacatccacgacagcttttcttc |
21745815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 34 - 147
Target Start/End: Complemental strand, 25766 - 25656
Alignment:
Q |
34 |
aagttgatcaaccttattaatattcatttgccctggttcataaagcatggcattctccgagatatgtagcaaagaacatccatccacgaacaacatccat |
133 |
Q |
|
|
|||||||||||||||| |||||||||| |||||| | || | | ||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
T |
25766 |
aagttgatcaacctta---atattcattttccctgggttattacgtctggcattctccaagatatgtagcaaagaacatccatccacgaacaacatcaac |
25670 |
T |
 |
Q |
134 |
gataacttttcttc |
147 |
Q |
|
|
|| | ||||||||| |
|
|
T |
25669 |
gacagcttttcttc |
25656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 103 - 147
Target Start/End: Original strand, 18192060 - 18192104
Alignment:
Q |
103 |
caaagaacatccatccacgaacaacatccatgataacttttcttc |
147 |
Q |
|
|
|||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
T |
18192060 |
caaagaacatccatccacaaacaacatccatgatagcttttcttc |
18192104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 710 times since January 2019
Visitors: 6705