View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_51 (Length: 245)
Name: NF0929_low_51
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0929_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 40010857 - 40010973
Alignment:
| Q |
1 |
ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcatcaactatgttcaggaaatagaacgtcaagttcctttaatggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010857 |
ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcctcgactatgttcaggaaatagaacgtcaagttcctttaatggat |
40010956 |
T |
|
| Q |
101 |
gaaatggacgcaaaggt |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40010957 |
gaaatggacgcaaaggt |
40010973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 148 - 237
Target Start/End: Original strand, 40010985 - 40011074
Alignment:
| Q |
148 |
tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010985 |
tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct |
40011074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 998 times since January 2019
Visitors: 6708