View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0929_low_53 (Length: 226)
Name: NF0929_low_53
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0929_low_53 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 42038750 - 42038541
Alignment:
Q |
17 |
gacacgtacttagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcata |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42038750 |
gacacgtacttagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcata |
42038651 |
T |
 |
Q |
117 |
gtatggccaagatgcaatggagttgcagcagatgtaggtgtatggtacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacattgct |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42038650 |
gtatggccaagatgcaatggagttgcagcagatgtaggtgtatggtacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacattgca |
42038551 |
T |
 |
Q |
217 |
aggcctggct |
226 |
Q |
|
|
|||||||||| |
|
|
T |
42038550 |
aggcctggct |
42038541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1255 times since January 2019
Visitors: 6711