View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0929_low_53 (Length: 226)

Name: NF0929_low_53
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0929_low_53
NF0929_low_53
[»] chr1 (1 HSPs)
chr1 (17-226)||(42038541-42038750)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 42038750 - 42038541
Alignment:
17 gacacgtacttagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcata 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42038750 gacacgtacttagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcata 42038651  T
117 gtatggccaagatgcaatggagttgcagcagatgtaggtgtatggtacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacattgct 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
42038650 gtatggccaagatgcaatggagttgcagcagatgtaggtgtatggtacacctgattcctcaatcacacgtctaaccaaacgtttctgtttgtacattgca 42038551  T
217 aggcctggct 226  Q
    ||||||||||    
42038550 aggcctggct 42038541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1255 times since January 2019
Visitors: 6711