View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_high_12 (Length: 255)
Name: NF0930_high_12
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0930_high_12 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 97 - 255
Target Start/End: Original strand, 42271432 - 42271590
Alignment:
Q |
97 |
ttgttttgataagaaatgtttgtatattttaattacaactaatttactttcttatgtaaaataatttatagaggtgttggatcaaatggagagttacaca |
196 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
42271432 |
ttgttttgataagaaatgtttgtatattttaattacaactaatttactttcttatgtaaaataatttatagaggtgttgattcaaatggagagttacaca |
42271531 |
T |
 |
Q |
197 |
acaacaaagaaattggagagaatttattggatggaatatcatcaaaaaccatgacaaac |
255 |
Q |
|
|
||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
T |
42271532 |
acaaccaagaaattggagagaatttcttggatggactatcatcaaaaaccatgacaaac |
42271590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University