View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_high_15 (Length: 251)
Name: NF0930_high_15
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0930_high_15 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 28 - 251
Target Start/End: Complemental strand, 19396049 - 19395824
Alignment:
| Q |
28 |
caggaataacagcacaccaactcagaccaaatggttgaagtctgcaactttcagtg--acaaatgtattggcctttgtatgtgtcttagtgatgagtaca |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396049 |
caggaataacagcacaccaactcagaccaaatggttgaagtctgcaactttcagtgtgacaaatgtattggcctttgtatgtgtcttagtgatgagtaca |
19395950 |
T |
 |
| Q |
126 |
agcagttttaagaagaggatttaactgagctgggttacattttccaaaaatgtattatgctcaaaaatagctaaagatgtattcatgaatatgatactct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19395949 |
ggcagttttaagaagaggatttaactgagctgggttacattttccaaaaatgtattatgctcaaaaatagctaaagatgtattcatgaatatgatactct |
19395850 |
T |
 |
| Q |
226 |
tgttaatgaaatggaataagttttcc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
19395849 |
tgttaatgaaatggaataagttttcc |
19395824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 134
Target Start/End: Complemental strand, 2254615 - 2254551
Alignment:
| Q |
70 |
tgcaactttcagtgacaaatgtattggcctttgtatgtgtcttagtgatgagtacaagcagtttt |
134 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| |||||||| | |||| |||||||||||| |
|
|
| T |
2254615 |
tgcaactttcagtgactaatgtattggccttggtatatgtcttagagttgagaacaagcagtttt |
2254551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 70 - 124
Target Start/End: Complemental strand, 9493431 - 9493377
Alignment:
| Q |
70 |
tgcaactttcagtgacaaatgtattggcctttgtatgtgtcttagtgatgagtac |
124 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
9493431 |
tgcagctttcagtgacaaatgtattcgccttggtatgtgtcttagagatgagtac |
9493377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 144 - 213
Target Start/End: Complemental strand, 11509076 - 11509007
Alignment:
| Q |
144 |
atttaactgagctgggttacattttccaaaaatgtattatgctcaaaaatagctaaagatgtattcatga |
213 |
Q |
| |
|
|||||||| ||| || |||||| ||||||| ||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
11509076 |
atttaacttagccaggctacattgtccaaaattgtattacacttaaaaatagctaaagttgtattcatga |
11509007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University