View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_low_11 (Length: 387)
Name: NF0930_low_11
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0930_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 103 - 376
Target Start/End: Complemental strand, 2551706 - 2551440
Alignment:
| Q |
103 |
ataaacatgttttttgttgggtttgcattgaagcttgttctttagagaaacacaaaattcaagcatttt---ttgtctttcttttctttatactcttgaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2551706 |
ataaacatgttttttgttgggtttgcattgaagcttgttctttagagaaacacaaaattcaagcattttaatttgtctttcttttctttatactcttgaa |
2551607 |
T |
 |
| Q |
200 |
aaatattctannnnnnnnnnnnnnnnnntagaatatttttcaatgtattccaaatgcaaaggcaaggtaacaaataaggaatctatttttattttcattt |
299 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551606 |
aaatattctaatatatata----------agaatatttttcaatgtattccaaatgcaaaggcaaggtaacaaataaggaatctatttttattttcattt |
2551517 |
T |
 |
| Q |
300 |
acacggttacttcatatgcaagttttttgcaaataaattccatgtgtaacatgatatacattattcattgatttcat |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551516 |
acacggttacttcatatgcaagttttttgcaaataaattccatgtgtaacatgatatacattattcattgatttcat |
2551440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University