View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_low_16 (Length: 342)
Name: NF0930_low_16
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0930_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 23193119 - 23193429
Alignment:
Q |
1 |
aaattgatgttttcttggtaaattattttgtcacagatacactggccgtttaggacgaagtcgggatcaaggggttgggaccctgaggtcatggttccct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23193119 |
aaattgatgttttcttggtaaattattttgtcacagatacactggccgtttaggacgaagtcgggatcaaggggttgggaccctgaggtcatggttccct |
23193218 |
T |
 |
Q |
101 |
tatgtctttcagagacatggaatgcaatggaaggtttattcgcctcaggtcaagcacgtgcgattggtgtcagcaacttttcaactaagaagcttcaaga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23193219 |
tatgtctttcagagacatggaatgcaatggaaggtttattcgcctcaggtcaagcacgtgcgattggtgtcagcaacttttcaactaagaagcttcaaga |
23193318 |
T |
 |
Q |
201 |
cttactcggatatgctaagattccgccagcagttaaccaagttgaatgccatcctgtttggcaacaaccagctcttcataatttgtgcaattctactggt |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23193319 |
cttactcggatatgctaagattccgccagcagttaaccaagttgaatgccatcctgtttggcaacaaccagctcttcataatttgtgcaattctactggt |
23193418 |
T |
 |
Q |
301 |
gttcatctcac |
311 |
Q |
|
|
||||||||||| |
|
|
T |
23193419 |
gttcatctcac |
23193429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University