View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_low_21 (Length: 306)
Name: NF0930_low_21
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0930_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 54 - 230
Target Start/End: Complemental strand, 27065832 - 27065656
Alignment:
| Q |
54 |
tgagatgaagcaggtatttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa |
153 |
Q |
| |
|
|||||||||||| || || |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27065832 |
tgagatgaagcaagttttcaaggtgtccgagaattcttcgatgaataagatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa |
27065733 |
T |
|
| Q |
154 |
acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27065732 |
acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcg |
27065656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 54 - 212
Target Start/End: Complemental strand, 27079549 - 27079391
Alignment:
| Q |
54 |
tgagatgaagcaggtatttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa |
153 |
Q |
| |
|
|||| ||||||| || ||||||||||| |||||||| |||||| | || ||||| ||||| | ||| ||||||| |||||||| |||||| | ||||| |
|
|
| T |
27079549 |
tgagttgaagcaagtttttaaggtgtctgagaattcctcgatggataagatgatagtggactcattgggtgagtgtgagagggcaccgagtatgggtgag |
27079450 |
T |
|
| Q |
154 |
acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttggg |
212 |
Q |
| |
|
|| ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
27079449 |
acaaagcgttgtgttggttcacttgaggatatgattgactttgcaacttcagttttggg |
27079391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 118 - 213
Target Start/End: Complemental strand, 27053326 - 27053231
Alignment:
| Q |
118 |
ttgagtgagtgcgagagggcgccgagtgtaggtgaaacgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggt |
213 |
Q |
| |
|
||||||||||| || || ||||| ||| |||||| | ||||||||||| ||||| |||||||| |||||||| |||||||||||| |||||||| |
|
|
| T |
27053326 |
ttgagtgagtgtgaaagagcgccaagtaaaggtgagatcaagcgttgtgtaggttcgcttgaggacatgattgactttgcaacttctattttgggt |
27053231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University