View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_low_32 (Length: 252)
Name: NF0930_low_32
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0930_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 5329318 - 5329377
Alignment:
| Q |
25 |
ctttctagaaattcaaatttcccccttaaaatatactttttattttatttcaacttgtcc |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5329318 |
ctttctagaaattcaaatttcccccttaaaatatactttttattttatttcaacttgtcc |
5329377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 20433424 - 20433483
Alignment:
| Q |
25 |
ctttctagaaattcaaatttcccccttaaaatatactttttattttatttcaacttgtcc |
84 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20433424 |
ctttctagaaattcaaatttccctcttaaaatatactttttattttatttcaacatgtcc |
20433483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University