View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_low_41 (Length: 204)
Name: NF0930_low_41
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0930_low_41 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 83 - 204
Target Start/End: Complemental strand, 35542897 - 35542779
Alignment:
| Q |
83 |
ataatactagagaaacaatggataacaataactcaacaaaaccacccataaattgatgataactacttagagtagaaagaaagaaaaacactcttaggaa |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35542897 |
ataatactagagaaacaatggataacaataactcaacaaaaccacccataaattgatgata---acttagagtagaaagaaagaaaatcactcttaggaa |
35542801 |
T |
 |
| Q |
183 |
attagggtttgacatgagtaac |
204 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
35542800 |
attaaggtttgacatgagtaac |
35542779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 156 - 204
Target Start/End: Complemental strand, 35528332 - 35528284
Alignment:
| Q |
156 |
agaaagaaagaaaaacactcttaggaaattagggtttgacatgagtaac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35528332 |
agaaagaaagaaaaacactcttaggaaattagggtttgacatgagtaac |
35528284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University