View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0930_low_8 (Length: 431)
Name: NF0930_low_8
Description: NF0930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0930_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 84 - 336
Target Start/End: Original strand, 41430138 - 41430391
Alignment:
| Q |
84 |
ttctaaccaacgtgtgtggatatagacatttatgcggctagtatgcactactaaaactaaatacacaatcttaataataacgtaacataacatgttgaaa |
183 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41430138 |
ttctaaccaacgtgtgtggagatagacatttatgcggctagtatgcactagtaaaactaaatacacaatcttaataataacgtaacataacatgttgaaa |
41430237 |
T |
|
| Q |
184 |
aattaacttacgaacttaggacatataattcaggttgctcagattttggttgaagagttggagcgagtcatgagcataggaggttaactgagaagttgaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41430238 |
aattaacttacgaacttaggacatataattcaggttgctcagattttggttgaagagttggagcgagtcatgagcataggaggttaactgagaagttgaa |
41430337 |
T |
|
| Q |
284 |
ccacatatgtgaccaccactatattgatttgcaaaagcc-tttgagtaaataat |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41430338 |
ccacatatgtgaccaccactatattgatttgcaaaagccttttgagtaaataat |
41430391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University