View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_high_21 (Length: 314)
Name: NF0931_high_21
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0931_high_21 |
 |  |
|
[»] scaffold0026 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 53744480 - 53744702
Alignment:
Q |
1 |
aattacagagcaagagcgagtagtacctgttcttcactcatgagttgctggagtctctctttaagagcaggaccatgccggccgccgctacgagcattga |
100 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53744480 |
aattacagagcaagagcgaggagtacctgttcttcactcatgagttgctggagtctttctttaagagcaggaccatgccggccgccgctacgagcattga |
53744579 |
T |
 |
Q |
101 |
tgaaaacaaccataggagaagtcggagcagcggagtcttctccttcagcgcgattccggtaaagagtttctccagcggaaggatcttgaagacgaatgga |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
53744580 |
tgaaaacaaccataggagaagtcggagcagcggagtcttctccttcagcgcgattccggtaaagagtttctccggcggaaggatcttgaagacgaatgga |
53744679 |
T |
 |
Q |
201 |
atcacgcattgcgaagcgaagat |
223 |
Q |
|
|
|||||||||||| |||||||||| |
|
|
T |
53744680 |
atcacgcattgcaaagcgaagat |
53744702 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0026 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 23 - 110
Target Start/End: Original strand, 87981 - 88068
Alignment:
Q |
23 |
gtacctgttcttcactcatgagttgctggagtctctctttaagagcaggaccatgccggccgccgctacgagcattgatgaaaacaac |
110 |
Q |
|
|
|||||||||| ||||||||||| | |||||| ||||| || ||| | |||||||| || ||||| ||||| | ||| ||||||||||| |
|
|
T |
87981 |
gtacctgttcctcactcatgagatcctggagcctctccttgagaacgggaccatggcgaccgccactacggggattaatgaaaacaac |
88068 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University