View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_high_37 (Length: 251)
Name: NF0931_high_37
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 11635256 - 11635495
Alignment:
| Q |
1 |
catccatgatttattttctaaatttttatgctgcttaatgatggctttatgcatttgcagtggcactaatctgagatgcatgcggcttgtagaatgccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11635256 |
catccatgatttattttctaaatttttatgctgcttaatgatggctttatgcatttgcagtggcactaatctgagatgcatgcggcttgtagaatgccaa |
11635355 |
T |
 |
| Q |
101 |
tacatttcagatgaaggattttgcaaagctgtgagaaaac-tttgcagttagaggagttagagatttcattatgtagcctatcgaaggagtctcttgaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11635356 |
tacatttcagatgaaggattttgcaaagctgtgagaaaacttttgcagttagaggagttagagatttcattatgtagcctatcgaaggagtctcttgaag |
11635455 |
T |
 |
| Q |
200 |
tccttggccgatcttgccgtctttttaaatctctcatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11635456 |
tccttggccgatcttgccgtcttttaaaatctctcatatt |
11635495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 5569051 - 5568994
Alignment:
| Q |
177 |
cctatcgaaggagtctcttgaagtccttggccgatcttgccgtctttttaaatctctc |
234 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||||| | ||| ||||||||| |
|
|
| T |
5569051 |
cctatcaaaggattctcttgaagtcctaggccgatcttgccctagtttaaaatctctc |
5568994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 5574032 - 5573975
Alignment:
| Q |
177 |
cctatcgaaggagtctcttgaagtccttggccgatcttgccgtctttttaaatctctc |
234 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||||| | ||| ||||||||| |
|
|
| T |
5574032 |
cctatcaaaggattctcttgaagtcctaggccgatcttgccctagtttaaaatctctc |
5573975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University